Commit dc9e198b authored by Adrien Leger's avatar Adrien Leger
Browse files

Update Sekator src and test with fastq containing 100k reads

parent 8d9fcc14
......@@ -54,8 +54,10 @@ docs/_build/
target/
# Specific target
scr/AdapterTrimmer.c
scr/AdapterTrimmer.o
scr/AdapterTrimmer.so
scr/AdapterTrimmer.html
src/AdapterTrimmer.c
src/AdapterTrimmer.o
src/AdapterTrimmer.so
src/AdapterTrimmer.html
src/build/
test/local_dataset/
test/test/
This diff is collapsed.
#########################################################################################
# #
# SEKATOR CONFIGURATION FILE #
# #
#########################################################################################
# Values can by customized with users values, but the file template must remain unchanged, otherwise the program will not be able to load default values.
# Please follow the following recommendations :
# - File path should be indicated as absolute path preferably and should not contain blank spaces
# - Values identified with '**' in the descriptor are not recommended to be modified
##########
[general]
##########
# Quality format associated with reads. Autorized values are : solexa, solexa-old or phred. See HTSeq documentation for more details. (STRING)
qual_scale : phred
# Minimal size of read after quality trimming or adapter trimming (POSITIVE INTEGER)
min_size = 0
# Use all available threads for parrallel processing (BOOLEAN)
auto_thread = True
# If auto_thread is "False" specify the maximal number of thread to use (POSITIVE INTEGER)
n_thread : 2
# Write a txt report (BOOLEAN)
write_report : True
# Compress the fastq output (BOOLEAN)
compress_output : True
# Output reads whose mate was discarded after trimming in a separate (BOOLEAN)
output_single : False
##########
[quality]
##########
# Perform quality trimming from the left extremity (BOOLEAN)
left_trim : True
# Perform quality trimming from the right extremity (BOOLEAN)
right_trim : True
# Size of the sliding window in which quality will be computed (POSITIVE INTEGER)
win_size : 6
# Step of sliding window during trimming (POSITIVE INTEGER)
step : 1
# Minimal quality in a given windows to be retained during trimming (0 <= POSITIVE INTEGER <= 40)
qual_cutdown : 30
##########
[adapter]
##########
# Perform adapter trimming (BOOLEAN)
adapter_trim : True
# Search for the reverse complement of each adaptors in reads ** (BOOLEAN)
find_reverse : False
# Minimal fraction of the length of a match between the adaptor and the read (0 < FLOAT <= 1) **
min_match_len : 0.3
# Minimal Score per base of a between the adaptor and the read (- higher_penalty <= FLOAT <= ssw_match) **
min_match_score : 1
# Gain in case of a match during stripped Smith and Waterman sequence alignment (POSITIVE INTEGER) **
ssw_match : 2
# Penatly in case of a mismatch during stripped Smith and Waterman sequence alignment (POSITIVE INTEGER) **
ssw_mismatch : 2
# Penatly or gain in case of ambiguous base (other that A,T,C or G) during stripped Smith and Waterman sequence alignment (INTEGER) **
ssw_ambiguous : 0
# Penatly in case of a gap opening during stripped Smith and Waterman sequence alignment (POSITIVE INTEGER) **
ssw_gapO : 3
# Penatly in case of a gap extenssion during stripped Smith and Waterman sequence alignment (POSITIVE INTEGER) **
ssw_gapE : 1
###############################
#  SAMPLE DEFINITIONS  #
###############################
# It is possible to include as many independant sample as required by duplicating a entire sample section and incrementing the id number in the sample section name
# Each sample section is organize as follow :
# name = Unique identifier that will be used to prefix the read files (STRING)
# R1_path = Valid path to the fastq file (gziped or not) containing the forward reads of the pair (preferably absolute path without spaces) (STRING)
# R1_path = Valid path to the fastq file (gziped or not) containing the reverse reads of the pair (preferably absolute path without spaces) (STRING)
# adapter_list = list of adapter DNA sequence to be trimmed if adapter_trimming is required. Separate each adapter by a blank space (LIST OF STR)
[sample1]
name : test
R1_path : ./testR1.fastq.gz
R2_path : ./testR1.fastq.gz
adapter_list : GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
/home/adrien/Bioinformatics/data/fastq/100k_AAV_R1.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/100k_AAV_R2.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/100kseq_R1.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/100kseq_R2.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/100seq_R1.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/100seq_R2.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/10k_AAV_R1.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/10k_AAV_R2.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/10kseq_R1.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/10kseq_R2.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/1M_AAV_R1.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/1M_AAV_R2.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/1kseq_R1.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/1kseq_R2.fastq.gz
\ No newline at end of file
/home/adrien/Bioinformatics/data/fastq/CONTROL_10000_R1.fastq.gz
\ No newline at end of file
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment