config.json 1.98 KB
Newer Older
Audrey BIHOUEE's avatar
Audrey BIHOUEE committed
1
{
Eric CHARPENTIER's avatar
Eric CHARPENTIER committed
2
3
4
5
6
        "project-name":"test-project",
        "outdir":"Results",
        "prinseq-meanquality":"30",
        "cutadapt-forward":"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC",
        "cutadapt-reverse":"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT",
7
        "library-type":"first-strand",
8
        "read-length":"100",
9
        "align-cpu":"1",
Eric CHARPENTIER's avatar
Eric CHARPENTIER committed
10
11
12
13
14
15
16
        "reference":
        {
                "name":"Ensembl_GRCh37",
                "description":"Homo sapiens Ensembl GRCh37",
                "STARindexDir":"CONFIG/genome",
                "fasta":"CONFIG/genome/human_g1k_v37.chr22.fasta",
                "gtf":"CONFIG/genome/chr22.gff",
17
                "biomart":"37,hsapiens_gene_ensembl"
Eric CHARPENTIER's avatar
Eric CHARPENTIER committed
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
        },
        "samplesCondition": [
                {
                        "name": "80_CT_1_chr22",
                        "condition": "CT"
                },
                {
                        "name": "81_CT_2_chr22",
                        "condition": "CT"
                },
                {
                        "name": "82_CT_3_chr22",
                        "condition": "CT"
                },
                {
                        "name": "83_CT_4_chr22",
                        "condition": "CT"
                },
                {
37
38
                        "name": "96_TREATED_1_chr22",
                        "condition": "TREATED"
Audrey BIHOUEE's avatar
Audrey BIHOUEE committed
39
                },
Eric CHARPENTIER's avatar
Eric CHARPENTIER committed
40
                {
41
42
                        "name": "97_TREATED_2_chr22",
                        "condition": "TREATED"
Eric CHARPENTIER's avatar
Eric CHARPENTIER committed
43
44
                },
                {
45
46
                        "name": "98_TREATED_3_chr22",
                        "condition": "TREATED"
Eric CHARPENTIER's avatar
Eric CHARPENTIER committed
47
48
                },
                {
49
50
                        "name": "99_TREATED_4_chr22",
                        "condition": "TREATED"
Audrey BIHOUEE's avatar
Audrey BIHOUEE committed
51
                }
Eric CHARPENTIER's avatar
Eric CHARPENTIER committed
52
53
54
        ],
        "comparisons": 
        {
55
                "TREATED__vs__CT": {
56
			"minLogFC": 0.58,
57
                        "condition1": "TREATED",
Eric CHARPENTIER's avatar
Eric CHARPENTIER committed
58
59
60
                        "condition2": "CT"
                }
        }
61
}