Commit dc40b301 authored by Eric CHARPENTIER's avatar Eric CHARPENTIER 🐍
Browse files

Merge branch 'develop' of...

Merge branch 'develop' of https://gitlab.univ-nantes.fr/bird_pipeline_registry/RNAseq_quantif_pipeline into develop
parents 9c57e669 1d8de39e
......@@ -4,34 +4,22 @@
{
"name":"Ensembl_GRCh37",
"description":"Homo sapiens Ensembl GRCh37",
"STARindexDir":"index-star-75b",
"fasta":"/commun/data/pubdb/ensembl/Hs/b37/human_g1k_v37.fasta",
"gtf":"/commun/data/pubdb/ensembl/Hs/b37/Homo_sapiens.GRCh37.75_short.gtf",
"STARindexDir":"CONFIG/genome",
"fasta":"CONFIG/genome/human_g1k_v37.chr22.fasta",
"gtf":"CONFIG/genome/chr22.gff",
"biomart":"feb2014.archive.ensembl.org,ENSEMBL_MART_ENSEMBL,hsapiens_gene_ensembl"
},
"replicates":{
"J0_CTRL": {
"name":"J0_CTRL",
"samples":["1_J0-1-ctrl","6_J0-2-ctrl","11_J0-3-ctrl"]
"CT": {
"name":"CT",
"samples":["80_CT_1_chr22","81_CT_2_chr22","82_CT_3_chr22","83_CT_4_chr22"]
},
"J3_CTRL": {
"name":"J3_CTRL",
"samples":["2_J3-1-ctrl","7_J3-2-ctrl","12_J3-3-ctrl"]
},
"J6_CTRL": {
"name":"J6_CTRL",
"samples":["4_J6-1-ctrl","9_J6-2-ctrl","14_J6-3-ctrl"]
},
"J3_LSD1": {
"name":"J3_LSD1",
"samples":["3_J3-1-LSD1","8_J3-2-LSD1","13_J3-3-LSD1"]
},
"J6_LSD1": {
"name":"J6_LSD1",
"samples":["5_J6-1-LSD1","10_J6-2-LSD1","15_J6-3-LSD1"]
"BEZ": {
"name":"BEZ",
"samples":["96_BEZ_1_chr22","97_BEZ_2_chr22","98_BEZ_3_chr22","99_BEZ_4_chr22"]
}
},
},
"prinseq-meanquality":"30",
"cutadapt-forward":"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC",
"cutadapt-reverse":"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT",
......@@ -39,4 +27,3 @@
"read-length":"75",
"align-cpu":"10"
}
{
"Ensembl_GRCh37":
{
"name":"Ensembl_GRCh37",
"description":"Homo sapiens Ensembl GRCh37",
"fasta":"CONFIG/genome/human_g1k_v37.chr22.fasta",
"gtf":"CONFIG/genome/chr22.gff",
"biomart":"feb2014.archive.ensembl.org,ENSEMBL_MART_ENSEMBL,hsapiens_gene_ensembl"
}
}
\ No newline at end of file
No preview for this file type
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment