... | @@ -59,6 +59,10 @@ AGTTCTCACGCTAGGTCTCCTCCGGGCGCTTCCCTAGCCCGTTCGCCGCCTGAGAGGGAC |
... | @@ -59,6 +59,10 @@ AGTTCTCACGCTAGGTCTCCTCCGGGCGCTTCCCTAGCCCGTTCGCCGCCTGAGAGGGAC |
|
GCTGTTCCGCCGCGTGGAAGCTTCGAGTCTCGACTCCACTGTTGACCCCTAGA.......
|
|
GCTGTTCCGCCGCGTGGAAGCTTCGAGTCTCGACTCCACTGTTGACCCCTAGA.......
|
|
```
|
|
```
|
|
|
|
|
|
|
|
> **Important Note:** :warning:
|
|
|
|
|
|
|
|
> - The fasta track names should not be greater than 60 characters. A folding of the file will be run and if a track name is greater than 60 characters, it will also be folded resulting in errors at the alignment steps.
|
|
|
|
|
|
## The annotation file
|
|
## The annotation file
|
|
|
|
|
|
By default, this file is built by looking at the links between transcript names and gene names from the file `<species>_refGene.txt`.
|
|
By default, this file is built by looking at the links between transcript names and gene names from the file `<species>_refGene.txt`.
|
... | @@ -130,11 +134,13 @@ This command will produce the files |
... | @@ -130,11 +134,13 @@ This command will produce the files |
|
|
|
|
|
# Conclusion
|
|
# Conclusion
|
|
|
|
|
|
If you want the pipeline to automatically build you reference, you should only specify a genomic assembly that exists in refseq in your samplesheet. The pipeline has been tested with "hg19, hg38, mm10". For "rn6", the chrM is missing in the default path, so it has to be downloaded by hand.
|
|
- If you want the pipeline to automatically build you reference, you should only specify a genomic assembly that exists in refseq in your samplesheet. The pipeline has been tested with "hg19, hg38, mm10". For "rn6", the chrM is missing in the default path, so it has to be downloaded by hand.
|
|
|
|
|
|
|
|
- If you want to manually build your reference with you own transcript sequences then you have to build the two files:
|
|
|
|
- `<species>_ERCC_chrm.fa` : merging of mRNA sequences, ERCC and chrM fasta files.
|
|
|
|
- `<species>_sym2ref.dat` : gene symbol to transcripts names file.
|
|
|
|
|
|
If you want to manually build your reference with you own transcript sequences then you have to build the two files:
|
|
Add those files to a folder named `<species>` and specify the parent folder as the reference folder to the `make_srp_config.py` script using the `-r` option.
|
|
- `<species>_ERCC_chrm.fa` : merging of mRNA sequences, ERCC and chrM fasta files.
|
|
|
|
- `<species>_sym2ref.dat` : gene symbol to transcripts names file.
|
|
|
|
|
|
|
|
<div align="right">
|
|
<div align="right">
|
|
|
|
|
... | | ... | |